Emergence of Functional -Opioid Receptors Induced by Long-Term Treatment with Morphine

Opioid analgesics remain the choice for the treatment of moderate to severe pain. Recent research has established that the -opioid receptor is predominantly responsible for mediating many opioid actions, including analgesia and opioid tolerance. However, the function of -opioid receptors is rather puzzling at present, with inconsistent reports of system effects by agonists of -opioid receptors. The functional interaction between -opioid receptors and -opioid receptors is also poorly understood. In this study, we demonstrated that in a brainstem site critically involved in opioid analgesia, agonists of -opioid receptors, ineffective in opioid naive rats, significantly inhibit presynaptic GABA release in the brainstem neurons from morphine-tolerant rats. In membrane preparation from control brainstem tissues, Western blot detected no proteins of -opioid receptors, but consistent -opioid receptor proteins were expressed in membrane preparation from morphine-tolerant rats. Immunohistochemical studies revealed that long-term morphine treatment significantly increases the number of -opioid receptor-immunoreactive varicosities that appose the postsynaptic membrane of these neurons. The colocalization of -opioid receptor-immunoreactive varicosities with the labeling of the GABA-synthesizing enzyme glutamic acid decarboxylase is also significantly increased. From a behavioral perspective, activation of -opioid receptors in the brainstem nucleus, lacking an effect in opioid naive rats, became analgesic in morphine-tolerant rats and significantly reduced morphine tolerance. These findings indicate that long-term morphine treatment induces the emergence of functional -opioid receptors and -opioid receptor-mediated analgesia, probably through receptor translocation to surface membrane in GABAergic terminals. They also suggest that opioid drugs with preference for -opioid receptors may have better therapeutic effect in a -opioid-tolerant state. Opioids are still the most effective analgesics for the treatment of moderate to severe pain, such as cancer pain. Recent studies, particularly those using opioid receptor knockout mice, have clearly established that the -opioid receptor is predominantly responsible for mediating major opioid actions, including analgesia, reward, and the development of opioid tolerance and dependence (Matthes et al., 1996; Sora et al., 1997; Kieffer, 2000). However, the function of the -opioid receptor remains puzzling at present (Fields, 2004). Abundant immunoreactivity for -opioid receptors has been illustrated in brain areas important for opioid analgesia (Arvidsson et al., 1995; Cheng et al., 1995; Commons et al., 2001), but no cellular effect of -opioid receptors on neurons in these brain areas has been demonstrated in normal conditions. From a behavioral standpoint, agonists of -opioid receptors produce little to weak analgesic effects under normal conditions in animal studies and in clinical applications (Inturrisi, 2002; Fields, 2004). Some of the -opioid receptor agonist-induced analgesia has been argued to result from the effect of recruited -opioid receptors (Kieffer, 2000; Scherrer et al., 2004). Other -opioid receptor agonist-mediated analgesia may be attributed to normally functional -opioid receptors in the spinal cord. The reasons for the lack of significant brain functions of -opioid receptors in pain modulation have thus far been unknown. The functional interaction between -opioid receptors and -opioid receptors under conditions of long-term opioid treatment is also poorly understood. A significant clinical problem in pain management with current opioid therapies is the development of analgesic tolerance to and dependence on repeatedly used agonists of -opioid receptors such as morphine. Because agonists of -opioid receptors seem to remain the primary and widely This work was supported by National Institute on Drug Abuse grants DA14524 (to Z.Z.P.) and 5K01DA00381 (to A.E.K.) and by an institutional fund of MD Anderson Cancer Center to Z.Z.P. Article, publication date, and citation information can be found at http://molpharm.aspetjournals.org. doi:10.1124/mol.105.019109. ABBREVIATIONS: NRM, nucleus raphe magnus; IPSC, inhibitory postsynaptic current; PCR, polymerase chain reaction; GAPDH, glyceraldehyde3-phosphate dehydrogenase; GAD, glutamic acid decarboxylase; CTAP, D-Phe-Cys-Tyr-D-Trp-Arg-Thr-Pen-Thr-NH2; norBNI, nor-binaltorphimine dihydrochloride; DAMGO, [D-Ala,N-Me-Phe,Gly-ol]-enkephalin; RT-PCR, reverse transcription-PCR. 0026-895X/06/6904-1137–1145$20.00 MOLECULAR PHARMACOLOGY Vol. 69, No. 4 Copyright © 2006 The American Society for Pharmacology and Experimental Therapeutics 19109/3096799 Mol Pharmacol 69:1137–1145, 2006 Printed in U.S.A. 1137 at A PE T Jornals on N ovem er 7, 2017 m oharm .aspeurnals.org D ow nladed from used analgesics for pain in the foreseeable future, the understanding of functions of -opioid receptors under conditions of shortand long-term treatment with opioids is of great significance for improvement of current opioid therapies by increasing analgesic efficacy and reducing tolerance. The nucleus raphe magnus (NRM) in the medulla is a crucial brainstem site for opioid-induced analgesia. Neurons in the NRM directly modulate pain transmission at the spinal cord via their descending projections to the dorsal horn (Scholz and Woolf, 2002; Fields, 2004). We have previously characterized the cellular mechanisms for -opioid receptor-mediated analgesia in the NRM and its functional interactions with the -opioid receptor (Pan et al., 1990, 1997). In this study, we examined functions of -opioid receptors in morphine-naive rats and in rats undergoing long-term morphine treatment, morphine-tolerant rats in both NRM slice preparations in vitro, and a rat model of morphine tolerance in vivo. We focused on a class of NRM neurons that lacks postsynaptic -opioid receptors, is activated by agonists of analgesic -opioid receptors through disinhibition (inhibition of GABA synaptic inputs), and presumably inhibits spinal pain transmission through descending inhibition (Pan et al., 1997; Fields, 2004). Materials and Methods All procedures involving the use of animals conformed to the guidelines set by the University of Texas-MD Anderson Cancer Center Animal Care and Use Committee. Long-Term Morphine Treatment. Male Wistar rats underwent long-term treatment with morphine to induce morphine tolerance as described previously (Pan, 2003). For whole-cell recordings, neonatal rats (9–14 days old) were randomly divided into two groups. One group was injected (i.p.) with increasing doses of morphine twice daily for 6 days. The morphine dose was 10 mg/kg on day 1 and was increased by 5 mg/kg each day to reach the maximum doses of 30 mg/kg on days 5 and 6. The other group was injected with saline for controls. The injection volume was 0.1 to 0.3 ml. Neonatal rats were used for better visualization of neurons in brain slices for visualized whole-cell recording. It has been shown that the physiological and pharmacological properties of neurons from these young rats are indistinguishable from those of adult rats (Pan et al., 1997). For molecular, immunohistochemical, and behavioral experiments, rats (200–300 g) were treated with morphine by subcutaneous implantation of morphine pellets. One morphine pellet (75 mg) was implanted on day 1, and two more morphine pellets were implanted on day 4. The same numbers of placebo pellets were implanted on the same schedule in a separate group of rats as controls. On day 7, brain slice preparations were made for whole-cell recordings, or behavioral experiments were conducted, or NRM tissues were taken for analysis. Although developmental differences exist, our previous studies have shown that those cellular studies in slices from neonatal rats serve well as guidelines for mechanisms underlying behavioral effects observed in adult rats (Pan et al., 1997; Bie et al., 2005). Brain Slice Preparations. The rat brain was cut in a vibratome in cold (4°C) physiological saline to obtain brainstem slices (200 m thick) containing the NRM. A single slice was submerged in a shallow recording chamber and perfused with preheated (35°C) physiological saline (126 mM NaCl, 2.5 mM KCl, 1.2 mM NaH2PO4, 1.2 mM MgCl2, 2.4 mM CaCl2, 11 mM glucose, and 25 mM NaHCO3, saturated with 95% O2 and 5% CO2, pH 7.2–7.4). Slices from morphinetreated rats (tolerant group), as well as slices from saline-treated rats (control group), were maintained in 1 M morphine in vitro throughout the recording experiment to prevent morphine withdrawal as described previously (Ingram et al., 1998; Bie and Pan, 2005). A third group of slices (normal group) from saline-treated rats and kept in morphine-free solution was used as controls for the short-term morphine treatment. Whole-Cell Recordings and Data Analysis. Visualized wholecell voltage-clamp recordings were obtained from identified NRM neurons with a glass pipette (resistance, 3–5 M ) filled with a solution containing 126 mM KCl, 10 mM NaCl, 1 mM MgCl2, 11 mM EGTA, 10 mM HEPES, 2 mM ATP, and 0.25 mM GTP, pH adjusted to 7.3 with KOH; osmolarity, 280 to 290 mOsM. An AxoPatch-1D amplifier and AxoGraph software (Axon Instruments, Inc., Union City, CA) were used for data acquisition and on-line/off-line data analyses. A seal resistance of 2 G or above and an access resistance of 15 M or less were considered acceptable. Series resistance was optimally compensated. The access resistance was monitored throughout the experiment. All NRM cells included in this study were identified as a cell type that lacks the -opioid receptor, according to the criteria described in our previous study (Pan et al., 1990). Electrical stimuli of constant current (0.25 ms, 0.2–0.4 mA) were used to evoke a GABA-mediated inhibitory postsynaptic current (IPSC), with bipolar stimulating electrodes placed close to the recorded cell. With KCl-filled electrodes, GABA IPSCs were in an inward direction (Pan et al., 1990). Miniature IPSCs were obtained in 60-s epochs in the presence of tetrodotoxin (1 M). The AxoGraph software was used to detect and measure the amplitude and intervals of synaptic events and to analyze their distribution data. On average, cells displayed 128 29 synaptic events of GABA IPSCs during a 60-s period in normal conditions (n 11). All GABA IPSCs were recorded in the presence of glutamate receptor antagonists D-( )-2-amino-5-phosphonopentanoic acid (30 M) and 6-cyano-7nitroquinoxaline-2,3-dione (10 M) with a holding potential of 60 mV. Drugs were generally applied through the bath solution unless specified otherwise. Relative Quantitative Real-Time PCR and Western Blotting. Both methods have been published previously (Bie et al., 2005). NRM tissues were taken from morphineor placebo-treated rats (n 9 in each group). The primer sequences for PCR were: -opioid receptor: TGGGTCTTGGCTTCAGGTGT (forward), CGTGCATACCACTGCTCCAT (reverse); and GAPDH: TGCACCACCAACTGCTTAGC (forward), GGCATGGACTGTGGTCATGAG (reverse). Real-time PCRs were performed using SYBR Green RT-PCR Reagents kit and the ABI 7000 Sequence Detection System (Applied Biosystems, Foster City, CA). The GAPDH gene was used as an internal normalizer. Data were analyzed using the 2 Ct method described by Livak and Schmittgen (2001). For Western blotting, NRM tissues from morphine(n 10) and placebo(n 8) treated rats were homogenized and divided into two parts to extract total and membrane proteins separately. Total proteins were prepared after tissue lysis and centrifugation for SDS-polyacrylamide gel electrophoresis. Membrane protein was extracted with a Membrane Protein Extraction Reagent kit (Pierce, Rockford, IL). Samples were incubated overnight with a primary antibody for -opioid receptors (1:2000; Chemicon, Temecula, CA) and for GAPDH (1:1000; Santa Cruz Biotechnology, Santa Cruz, CA). Immunoreactive proteins were detected by enhanced chemiluminescence (ECL Advance kit; GE Healthcare, Little Chalfont, Buckinghamshire, UK). The intensity of bands was quantitatively analyzed with the software Kodak 1D v.3 (Eastman Kodak Co., Rochester, NY). For Endo F treatment, total protein samples were incubated with 1 l of Endo F1, F2, or F3 and respective 5 reaction buffer (Native Protein Deglycosylation Kit NDEGLY; Sigma, St. Louis, MO) at 37°C for 2 to 5 h. The reaction products were analyzed on SDS-polyacrylamide gel electrophoresis. Quantitative Immunohistochemistry. The general methods are similar to those reported previously (Kalyuzhny et al., 1996; Kalyuzhny and Wessendorf, 1998). Serial sections (10 m) containing the NRM were cut from the brainstem of fixed rats pretreated with morphine (n 4) or placebo (n 4). Sections were processed for double-labeling immunofluorescence using rabbit antisera directed against the cloned -opioid receptor (1:1000 dilution; a gift from Dr. Bob Elde, College of Biological Sciences, University of Minnesota, 1138 Ma et al. at A PE T Jornals on N ovem er 7, 2017 m oharm .aspeurnals.org D ow nladed from St. Paul, MN) (Arvidsson et al., 1995) and mouse monoclonal antibodies against glutamic acid decarboxylase (GAD)-6 (1:200 dilution) (Kalyuzhny and Wessendorf, 1998). For apposition experiments, sections were incubated with -opioid receptor antiserum and then counterstained with Fluoro Nissl Green (Quinn et al., 1995). Quantitative analysis of confocal microscopic images was conducted on a 408 136m area within the NRM on four randomly selected sections per rat in each group. The number of single-labeled -opioid receptors and GAD varicosities and the number of double-labeled -opioid receptors/GAD varicosities were quantified with customdesigned image analysis software (MVS Pacific, Minneapolis, MN). Profiles were defined as double-labeled for -opioid receptors and GAD if both appeared in profiles overlapping (yellow color) after merging of pseudocolored images of -opioid receptors (red color) and GAD (green color). NRM neurons were considered apposed by -opioid receptor-immunoreactive profiles if there was no conceivable distance observed between -opioid receptor-immunoreactive varicosities and cell membrane counterstained with Fluoro Nissl Green